CATEGORIES: BiologyChemistryConstructionCultureEcologyEconomyElectronicsFinanceGeographyHistoryInformaticsLawMathematicsMechanicsMedicineOtherPedagogyPhilosophyPhysicsPolicyPsychologySociologySportTourism |
ATGGAAGAAGAATATCGTTATATTCCTC CTCCTCAACAACAA
He looked at the next highlighted portion, and compared it with the first. He realized it was exactly the same sequence. In a group of not even a thousand bases, the exact same sequence occurred twice.
Above: between #535 and #576, and again between #815 and #856, one can observe the repetition of the 42 bases ATGGAAGAA-GAATATCGTTATATTCCTCCTCCTCAACAACAA.
Base triplets (codons) are translated into amino acids according to the principles outlined in the chart above. For example, TCT is serine (Ser), AAT is asparagine (Asn), GAA is glutamic acid (Glu). "Stop" signifies the end of a gene; the beginning code is ATG.
Below are the abbreviated and full names of the twenty amino acids:
Ando shifted his gaze from the printout to Nemoto's face. "No matter where we slice it, we always find this identical sequence." "How many of these are there?" "Bases, you mean?" "Yeah." "Forty-two." "Forty-two. So, fourteen codons, right? That's not very many." "We think it means something," Nemoto said, shaking his head. "But, Dr Ando, the strange thing is…" Miyashita interrupted. "This meaningless repetition was only found in the virus collected from Ryuji Takayama's blood, and not from the other two victims." He threw up his hands in a gesture of perplexity. In other words.. . Ando tried to find a suitable analogy. Suppose three people, one being Ryuji, had copies of Shakespeare's King Lear. Then suppose that Ryuji's copy, and only his copy, had meaningless strings of letters sandwiched in between the lines. There were forty-two bases, and they worked in sets of three, each set corresponding to one amino acid. If you assigned each of these sets a letter, you'd have a series of fourteen letters. And these fourteen repeating letters were found on every page of the play, inserted at random. If you knew from the beginning that the play was King Lear, of course, it would be possible to go back and find the meaningless parts that had been interpolated and highlight them. "So what do you think?" Miyashita looked to be sincerely interested in Ando's opinion. A true scientist, he was always most excited when confronted with the inexplicable. "What do I think? I'd have to know more before I could say anything." The three of them fell silent, glancing at one another's faces. Ando felt awkward, still holding the printout. Something was tugging at his consciousness. In order to figure out what it was, he needed time to sit down and study the meaningless string of bases. He had an unmistakable premonition that there was something here. The question was, what? And if this meaningless base sequence had indeed been interpolated, when had it happened? Was the virus that had invaded Ryuji's body just different? Or had it mutated in Ryuji's body, with the fourteen-codon string appearing here and there as a result of that mutation? Was that even possible? And if it was, what did it mean? An oppressive silence fell over the three men. No amount of speculation at this point could tell them how to interpret these findings. It was Miyashita who broke the silence. "By the way, did you come here for a reason?" Ando had been so intrigued by the discovery that his original errand had slipped his mind. "Right, I almost forgot." He opened up his briefcase, took out his planner, and showed Miyashita and Nemoto a slip of paper. "I was wondering if anyone here had a word processor of this model." Miyashita and Nemoto looked at the model name written on the paper. It was a fairly common machine. "Does it have to be exactly the same model?" "As long as it's the same brand, the model probably isn't important. Basically, it's a question of compatibility for a floppy disk." " Compatibility? " "Yes." Ando took a floppy disk from his briefcase. "I need to make a hard copy and a soft copy of the files on this disk." "It's not saved in MS-DOS, I take it?" "I don't think so." Nemoto clapped his hands, as if he'd just remembered something. "Hey, one of the staff members in my department-Ueda, I think-has this very model." "Do you suppose he'd let me borrow it?" Ando hesitated. He'd never met this Ueda. "I don't imagine there'd be a problem. He's fresh out of school." Nemoto spoke with the confidence of a senior staff member who knew that a new resident would do anything he asked. "Thanks." "No problem at all. Why don't we go over right now? I think he's there." This was music to Ando's ears. He couldn't wait to print out whatever was on this disk. "Great. Let's go." Ando dropped the disk back into his jacket pocket. Then, waving to Miyashita, he followed Nemoto out of the Pathology Department.
Ando and Nemoto walked side by side down the med school's dim hallway. Ando wore his lab coat unfastened in front, its tails swept back behind him, with his hands in the pockets of his jacket clutching the disk. Neither Miyashita nor Nemoto had asked about it. Ando wasn't trying to keep it a secret. Had Miyashita asked, he'd intended to give him an honest answer. If they'd known it might hold the key to this whole mystery, no doubt both men would have been at his heels right now. Of course, Ando hadn't seen what was on the disk yet. There was always the possibility that it held something else entirely. He simply wouldn't know until he managed to bring it up on a monitor. Still, it felt right in his hand: the disk was warm from being in his pocket. It was near body temperature. Its touch seemed to tell him that it held living words. Nemoto opened the door to the biochemistry lab. Ando took the disk out of his pocket, switched it to his left hand, and held the door open with his right. "Hey, Ueda." Nemoto beckoned to a skinny young man seated in a corner of the room. "Yes?" Ueda swiveled in his chair to face Nemoto, but didn't stand up. Nemoto approached him, smiling, and put his hand on Ueda's shoulder. "Are you using your word processor right now?" "No, not really." "Great. Would you mind if Dr Ando here borrowed it for a while?" Ueda looked up at Ando and then bowed. "Hello." "Sorry about this. I've got a disk I need to access and it's not compatible with my machine." Ando moved to Nemoto's side, holding up the disk. "Go right ahead," said Ueda, picking up the word processor from where it sat on the floor at his feet and laying it sideways on the desktop. "Do you mind if I check it right here just to make sure?" "Not at all." He opened the word processor's lid and turned it on. Soon the initial menu appeared on the screen. From among the options displayed, Ando chose DOCUMENTS, then inserted the disk. The next screen gave him two options: NEW DOCUMENT and OPEN DOCUMENT. Ando moved the cursor to the second option and hit return. With a whir, the machine started to read the disk. Finally, the names of the files stored on the disk appeared on the screen.
Ando read the file names aloud in a delirium. "Ring, ring, ring, ring…" Ring! What the hell? The same word that I got from solving the code that popped out of Ryuji's belly. "Are you alright?" Nemoto sounded worried. He was peering at Ando's suddenly dazed expression. Ando could barely manage to nod. There was no way this could be a coincidence. Asakawa had composed a report detailing this whole strange train of events, saved it in nine parts, and entitled it Ring. And then that title had extruded from Ryuji's belly. How to explain this? There is no way. Ando was in a state of complete denial. Ryuji's body was completely empty; he was like a tin man. Am I saying he slipped me a message from his abdominal cavity? That he was trying to tell me of the existence of these files? Ando recalled the way Ryuji's face had looked right after the autopsy. His square-jawed face had been smiling. Ando had expected that any minute he'd start laughing at him, stark naked on the table, jowls shaking. Deep down, Ando could feel Yoshino's outlandish story starting to take on the feel of reality. Maybe it was all true. Maybe there really was a videotape that killed you seven days after you watched it.
The word processor buzzed ceaselessly as it printed out page after page. Ando tore each page from the printer as it emerged and read through it quickly. Each page was single-spaced, but still Ando was able to read faster than the printer could spit them out. Wanting a hard copy, he'd decided to print it all out instead of reading it on the screen. Now he found himself getting frustrated by the two or three minutes it took each page to be printed. He'd ended up borrowing Ueda's machine and bringing it home with him. A quick check had revealed that the total report was close to a hundred pages, more than he could reasonably print out there in the lab. He had no choice but to stay up late at home. Now he was at the end of page twenty-one of the manuscript, alternating between reading it and taking bites of the dinner he'd picked up at the convenience store on the way home. What he'd read so far followed faithfully the outline Yoshino had given him the week before. But it differed from what Yoshino had told him after lunch at the cafe in that it contained specific times and places. As a result it was a good deal more persuasive. The reporterly style-no frills-also made it harder to disbelieve.
While investigating the simultaneous deaths by heart attack of four young people in Tokyo and Kanagawa prefecture on the evening of September 5 th, Asakawa had come up with the idea that the culprit was some kind of virus. Scientifically speaking, it was the obvious conclusion. And since autopsies on the four bodies had indeed revealed a virus that closely resembled smallpox, it turned out that Asakawa's hunch had been right. It had been Asakawa's guess that since the four had died at the same moment, they must have picked up the same virus together at the same place. He'd figured that the key to the whole case must lie in figuring out where they were exposed to the virus, that is, in determining the route of transmission. Asakawa had succeeded in finding out when and where the four had been together: August 29th, exactly a week before their deaths, at South Hakone Pacific Land, in a rented cabin, Villa Log Cabin No. B-4. The next page, page twenty-two, started with Kazuyuki Asakawa himself heading toward the cabin in question. He took the bullet train to Atami, then rented a car and took the Atami-Kannami highway to the highland resort. Rain and darkness limited the visibility, and the mountain road was awful. He'd made reservations for cabin B-4 at noon, but it was past eight at night when he finally checked in. So this was where those four kids had spent the night: the thought gave Asakawa a jolt of fear. Exactly a week after they'd stayed in this cabin, they were dead. He knew it was possible that the same spectral hand would touch him, too. But he couldn't overcome his reporterly curiosity and ended up searching B-4 from top to bottom. From something the kids had written in a notebook on the property, Asakawa determined that they had watched a videotape that night, so he went to the manager's office to search for that tape. He'd found an unlabelled, unboxed tape lying on the bottom shelf. Was this what he was looking for? With the manager's permission, he took the tape back to cabin B-4, and, with no way of knowing what it contained, he inserted it into the VCR in the living room and watched it all the way through. At first, everything was dark. Asakawa described the opening scene like this: In the middle of the black screen a pinpoint of light began to flicker. It gradually expanded, jumping around to the left and right, before finally coming to rest on the left-hand side. Then it branched out, becoming a frayed bundle of lights, crawling around like worms…
Ando looked up from the page. Based on what he was reading, he was able to get a reasonably clear image of what had been on the screen. Reading Asakawa's description of the opening, an image popped into his head that he felt he'd seen somewhere before. A firefly flitting around on a dark screen, growing gradually larger… then the point of light splays out like the fibers of a paintbrush. It was a short scene, but one that he could remember seeing, and recently at that. It didn't take long for the memory to come to him. It was when he'd gone to Mai's apartment to try and track her down. He'd found a videotape still in her VCR, and he'd pressed the play button. The one with Frank Sinatra, Liza Minnelli, etc., written on the label in a man's hand. The first few seconds of that tape had fit this description perfectly. But on the tape in Mai's apartment, this scene had only lasted a few seconds, before the screen suddenly became a lot brighter. In what had evidently been an attempt to erase whatever was on the tape, Mai had recorded morning variety shows, samurai melodrama reruns, whatever, until the tape ran out. Ando immediately figured out what this meant. Somehow, probably through Ryuji, Mai had acquired the problem tape and watched it in her apartment. Then, when she'd finished, she'd eradicated it, whatever it was, from the tape. She must have had her reasons. But she hadn't been able to erase the very beginning of the tape, so those first few seconds had remained there, lurking. Did it mean that the tape Asakawa had found in Villa Log Cabin had somehow made its way into Mai's hands? Ando tried to organize his thoughts. No, that can't be it. The tape Asakawa found and the tape Mai had were clearly two different things. According to the report, the one in the cabin was unlabelled. But the one in Mai's VCR had a title written on it in black marker. Which meant it must have been a copy. The one in the cabin was the original, and the one in Mai's place a copy. So that tape had been copied, erased, disguised, transported-a dizzying series of changes. In Ando's mind, the tape, occupying a point between the animate and the inanimate, began to resemble a virus. So, was Mai's disappearance a result of her having watched that tape? The possibility worried him. She hadn't been back to her room since then. She hadn't been showing up at school, and she hadn't even called her mother. On the other hand, he hadn't heard anything about a young woman found dead from unexplained causes. Ando let his mind wander for a while, considering all the things that could have befallen her. Maybe she'd died alone someplace unbeknownst to anybody. The thought pained him-she was only twenty-two. The fact that he could feel the first twinges of a crush on her only made it harder to bear. The printer finally came to the end of another page, with a noise that snapped Ando out of his reverie. In any case, now was no time to be borrowing trouble. At the moment, he'd be better off finding out what was on that tape first.
The next few pages contained a thorough description of the contents of the videotape. As he read, Ando could see a TV screen in his mind, filled with shifting images.
Something red and viscous spurted across the screen. This was followed by a view of a mountain that he could tell at a glance was an active volcano. Lava flowed from its mouth; the earth rumbled. The eruption lit up the night sky. Then this scene was suddenly cut off, replaced by a white background, in front of which the character for "mountain", written in black, faded in and out of view. Then a scene of two dice bouncing around on the bottom of a bowl. Finally a human figure appeared onscreen. A wrinkled old woman sat on a tatami mat. She was facing the camera and saying something. She spoke in a nearly incomprehensible dialect, but he could tell, more or less from the sound of her words, that she was predicting somebody's future, warning him or her. Next, a newborn baby, wailing. There was no discernible link between scenes. One followed another with all the abruptness and randomness of someone flipping over cards. The infant disappeared, replaced by hundreds of faces, filling the screen and multiplying as if by cellular division, all against the background of a multitude of voices intoning accusations: Liar! Fraud! Then an old television set, displaying the character sada. Then a man's face appeared. He was gasping for breath and dripping with sweat. Behind him could be seen a lush thicket of trees. His eyes were red and full of bloodlust; his mouth was contorted with screams and drool. His bare shoulder was deeply gouged, and blood flowed from the wound. Then came again, from nowhere in particular, the cry of a baby. In the center of the screen was a full moon, from which fell fist-sized stones, landing with dull thuds. Finally, more words appeared on the screen. Those who have viewed these images are fated to die at this exact hour one week from now. If you do not wish to die, you must follow these instructions exactly… And then the scene changed entirely. Instead of the prescribed method for avoiding certain death, the screen now showed a common television commercial for mosquito coils. The ad ended and the previous eerieness returned, or rather, the memory of it. At the end of this series of bizarre visions, Asakawa had managed to understand exactly two things. First, whoever watched this tape was doomed to die in exactly a week. And, second, there was a way to avoid this fate, but it had been deliberately recorded over. The four kids who'd watched the video first had erased it in a fit of malice or mischief. It was all Asakawa could do to slip the tape into his bag and flee cabin B-4.
Ando took a deep breath and lay the manuscript aside. Holy shit. In his report Asakawa had given a painstakingly elaborate account of the strange twenty minutes of images on the tape. He'd made every effort to recreate, using only words, what the video conveyed directly through sound and visuals, and he'd largely succeeded. The scenes still swirled around in Ando's mind, as vividly as if he'd seen and heard them himself. He sighed again, suddenly exhausted. Or maybe it wasn't fatigue. Perhaps it was that he now felt Asakawa's fear as his own, and wanted somehow to push it away. But even a moment's pause only whetted his desire to know more. Taking a sip of tea, he picked up the next page of the report, and started reading ahead, even faster than before.
The first thing Asakawa did upon returning to Tokyo was to call Ryuji Takayama and tell him what had happened. Asakawa had neither the time nor the courage to solve this thing alone. He needed a reliable partner, and so naturally his thoughts turned to Ryuji, whom he'd known since high school. He also approached Yoshino, but Yoshino refused to watch the video. Regardless of whether or not he actually believed in it, if there was even a slim chance that calamity would befall him as a result of watching the video, he wanted to avoid doing so. But not Ryuji. As soon as he heard about this video that'd kill in a week's time anyone who watched it, the first words out of his mouth were, First let's have a look at this video. So Ryuji watched the video in Asakawa's apartment, fascinated. And when it was over he asked Asakawa to make him a copy.
The word "copy" made Ando sit up and take notice. Now he thought he could figure out the route the tape had traveled. The original tape from Villa Log Cabin had most likely stayed in Asakawa's possession. It had been in the VCR in Asakawa's car at the time of the wreck, had passed to Asakawa's brother Junichiro, and been thrown away. There was one more tape, the one in Mai's apartment, the one with only the very beginning remaining. This was probably the copy Asakawa had made for Ryuji that first night. It had a title on the label, written in thick letters in a man's hand. It was probably Asakawa's handwriting. When Ryuji had asked Asakawa to make him a copy, instead of using a brand-new tape, Asakawa had recycled an old tape on which he'd originally recorded a music program. This had passed through Ryuji's hands into Mai's. That much made sense. But when had Mai received it? Mai had never mentioned having the tape to Ando. Which meant, Ando supposed, that she'd come across it by chance, several days after Ryuji's death, and watched it not knowing it was dangerous. In any case, the tape had been replicated in Asakawa's apartment. Ando felt he needed to keep that in mind.
So Ryuji took the copy of the tape back to his apartment and started working on figuring out the erased message (he and Asakawa called this "the charm"). Both men wondered what this weird recording was doing in Villa Log Cabin B-4. At first they thought that it had been shot with a video camera and then left there, but that turned out not to be the case. Three days before the unfortunate youths, a family had stayed in B-4, they'd put a tape in the VCR and set it to RECORD. They'd then forgotten about it and left it there when they went home. So the images on the tape had not been shot elsewhere and the tape brought to the cabin: rather, some sort of unknown transmission had been captured on the tape when the machine was recording. The next people on the scene had been the four young victims. With time on their hands, they'd decided to watch a video; when they went to turn on the VCR, out popped a tape. They'd watched it. The threat at the end must have amused them. Like we're really going to die in a week if we don't do what it says? So they decided to play a trick by erasing the solution; that should scare the next guests. Of course, the kids never really believed in the tape's curse. If they had, they never could have pulled such a stunt. In any case, the tape was found the next day by the manager, who put it on the shelf in the office, where it stayed unnoticed by anyone until Asakawa's arrival. So how had those images gotten into the deck while it was recording? It occurred to Asakawa that some maniac might have hijacked the airwaves, so he tried to pinpoint the source of such a broadcast. Meanwhile, when Asakawa was out of the house his wife and daughter found the video still in the VCR and watched it. Now Asakawa was urged on by the desire to save not only his own life, but also those of his family. Then Ryuji made a startling discovery. Watching the tape over and over at home, he had a flash of inspiration. He made a chart and found that the tape could be broken down into twelve scenes, which fell into two groups: abstract scenes that seemed to consist of what might be called mental imagery, and real scenes that seemed to have been seen through an actual pair of eyes. For example, the volcanic eruption and the man's face were clearly things that had really been seen, while the firefly-like light in the darkness at the beginning of the tape looked like something conjured up by the mind-like something out of a dream. So Ryuji called the two groups "real" and "abstract", for comparison's sake. Upon further investigation, he noticed that in the "real" scenes, there were instants in which the screen was covered by what looked like a black veil, just for a split second. In the "real" scenes, these instants occurred at the rate of about fifteen per minute, while in the "abstract" scenes, they didn't appear at all. What did this mean? Ryuji concluded that the black veil was in reality a blink. It appeared in the scenes that were seen with actual eyes, and not in the sequences that were only seen in the mind's eye. Not only that, the frequency of the blackouts matched the average eye-blinking frequency of a female. It seemed safe, then, to consider them eyeblinks. Which led naturally to the conclusion that the images on the videotape had not been captured by exposure in a video camera, but rather taken from the vision and imagination of an individual and placed on the tape by thought-projection.
Ando had real trouble believing this part. The idea that a person could mentally imprint images onto a videotape was simply preposterous. He might be willing, just barely, to allow the possibility of mentally imprinting photographic film, but moving images? That was an entirely different set-up, first of all. In order to press on, Ando had to lay this point aside for the moment, even as he admired Ryuji's perspicacity.
Assuming that someone had recorded the tape paranormally, the next question was: who? Asakawa and Ryuji concentrated on that point, heading to the Tetsuzo Miura Memorial Hall in Kamakura. A researcher into parapsychological phenomena, Miura had devoted his life to tracking down paranormals from all over Japan. The files containing his findings were now housed in his memorial. The two men got permission to examine those files, over a thousand in number, thinking that a psychic with powers strong enough to project moving images onto a videotape couldn't have escaped Professor Miura's notice. And, after several hours of searching, they'd found a likely candidate. Her name was Sadako Yamamura. She'd been born in the town of Sashikiji, on Izu Oshima Island. According to an entry in her file, at the age of ten she was already able to project the characters yama (mountain) and sada, elements from her name, onto a piece of film. These very characters had appeared on the video. Certain that this Sadako Yamamura was who they were looking for, Ryuji and Asakawa boarded a boat for Izu Oshima the next morning. They hoped that learning more about her upbringing and personality would illuminate some of the secrets of the videotape. Sadako was threatening whoever looked at her images with death in order to get the viewer to do something. The tape itself embodied her wish for that action to be undertaken. Which made it crucial that they find out what Sadako desired. At this point, Ryuji already had an inkling that Sadako Yamamura was no longer alive. It was his belief that on the brink of death she'd unleashed her final, unfulfilled desire in the form of a psychic projection, meaning to relay her wish to someone else. Her deepseated hatred had ended up on the videotape. Between the assistance of the Oshima stringer for the Daily News and the help of Yoshino in Tokyo, with whom they stayed in frequent contact, Asakawa and Ryuji managed to piece together a profile of Sadako Yamamura. She was born in 1947, the daughter of Shizuko Yamamura, a one-time paranormal who had made a big but temporary splash in the national media, and Heihachiro Ikuma, an Assistant Professor of Psychiatry at Taido University who had gotten into research on parapsychology with Shizuko as his subject. At first, the trio of Ikuma, Shizuko, and Sadako had been received by the public with simple curiosity, and in fact had become media darlings after a fashion. But once a certain prestigious academic society had pronounced Shizuko's powers fake, the masses turned on them, and they became subject to violent attacks in the media. Heihachiro was hounded out of the university, and eventually came down with tuberculosis, while Shizuko suffered nervous attacks and finally threw herself into Mt Mihara, the volcano on Izu Oshima. Sadako was taken in by some relatives on the island, where she lived until she graduated from high school. Once in fourth grade she gained some notoriety within the school by predicting an eruption of Mt Mihara, but aside from that she didn't display any of the powers she'd inherited from her mother. On leaving high school she moved to Tokyo, where she joined a theater troupe in hopes of making it as an actress. It was Yoshino who picked up her trail from there. Asakawa called Yoshino from the island and asked him to find the troupe's rehearsal space in Yotsuya, Tokyo. He did, and once there, he found out more about Sadako's true nature from a man named Arima, a leader of the troupe. It had been twenty-five years since Sadako had been a member of his company, but he recalled her very well. She seemed to have some sort of supernatural power; she could project images at will onto the screen of an unplugged television. If this was true, then Sadako's powers far outstripped her mother's. While at the rehearsal space, Yoshino succeeded in obtaining a photo of Sadako. They still had her resume on file, and it contained two black-and-white photos from when she joined. One was from the waist up, while the other was a full-length shot. Both revealed Sadako to have perfectly balanced features that went beyond even the word "beautiful". Yoshino was unable to determine what became of Sadako after she left the theater troupe, so he faxed the photos and the other information he'd gathered to Asakawa at the Daily News's Izu Oshima bureau. When he read the fax and found out that Sadako's trail had gone cold, Asakawa was devastated. If they couldn't find her, how could they hope to figure out the charm? Once again it was Ryuji who had a flash of inspiration. He realized that it might not be necessary to follow Sadako's every move. Instead, maybe they should turn their attention to the scene-Villa Log Cabin No. B-4-and try to figure out why the images had shown up there. She had to have some sort of connection with the place. They realized that all of the buildings at South Hakone Pacific Land were new. It wasn't impossible that something else had once stood there. Asakawa contacted Yoshino in Tokyo and asked him to try a new line of investigation: find out what had occupied that ground before the resort. Yoshino faxed him the next morning. It turned out that there had once been a tuberculosis sanatorium on the site. He even managed to send them a plan of the facility's layout. He also attached a file with the name, address, and resume of one Jotaro Nagao, age 57, a GP and pediatrician with a practice in Atami. For a period of five years, from 1962 to 1967, he had worked at the South Hakone Sanatorium. The suggestion seemed to be that any further information about the sanatorium would best be gleaned from Nagao. So, armed only with what they'd learned from Yoshino, Asakawa and Ryuji took a high-speed ferry for Atami. It was one week to the day since Asakawa had watched the video. If they didn't figure out the "charm" by ten that evening, Asakawa would die. Ryuji's deadline was ten o'clock the next night. And Asakawa's wife and daughter's time would be up at eleven on the morning after. The two men climbed back into their rented car and headed off to find Dr Nagao's office. Their hopes to gain even a tidbit of information from him were granted, in spades. When they finally came face to face with the doctor, both Asakawa and Ryuji recognized him. Near the end of the tape there was a part in which a man was seen from the waist up, panting and sweating, blood streaming from a gouge in his shoulder. Although he'd aged and lost some hair, Nagao was unmistakably that man. Sadako had seen his face up close. Not only that, in her "eyes" he was something wicked. With typical brashness, Ryuji pressured Nagao until he confessed everything. He told them all about that hot summer afternoon twenty-five years ago… Nagao had contracted smallpox from a patient while on a call to the sanatorium's isolation ward in the mountains, and that afternoon, the early symptoms of the illness were starting to show. But in spite of his headache and fever, he didn't recognize at first that he had smallpox, and went on treating tuberculosis patients as usual. He thought it was simply a cold. Then he met Sadako Yamamura in the courtyard. She often came to the sanatorium to visit her father, who was a patient there. Having just left the theater troupe, Sadako had nowhere else to go, and she was often up to see her father. One glance at Sadako and Nagao was overwhelmed by her beauty. He approached her and they began to talk, and then, as if guided by something beyond himself, he took her to an abandoned house deep in the woods. There, in front of an old well, he raped her. It was then that Sadako, in her desperate attempts to resist him, bit his shoulder. Between the bleeding and his feverish delirium, it took him some time to notice Sadako's uniqueness. She had testicular feminization syndrome, an extremely rare condition in which one had both male and female genitalia. A person with this syndrome usually has breasts and a vagina but lacks a uterus and fallopian tubes. Externally, the person would appear quite female, but chromosomally would be XY-a male-and unable to bear children. Nagao strangled Sadako and threw her body in the well. He then threw rocks into the well after her. After hearing out Nagao's confession, Asakawa showed him the plan of the resort and asked the doctor to show him on the map the location of the well. Nagao was able to indicate the general area-namely, where Villa Log Cabin was located now. Asakawa and Ryuji immediately sped off to Pacific Land. Once there, they began to search for the well in the vicinity of the cabins. They found it beneath cabin B-4. The cabin stood on a gentle slope, and when they investigated the space beneath the porch they saw the rim of an old well, covered with a concrete lid. If Sadako's hatred had radiated straight up out of the well, it would have run smack into the TV and VCR in the cabin above. The videotape was in the perfect position to pick up her psychic projections. Asakawa and Ryuji broke a few boards, crawled under the cabin, pried the lid off the well, and set about the task of finding Sadako's remains. That's what both Asakawa and Ryuji now interpreted the missing "charm" to be: Sadako wanted whoever watched the videotape to release her from that cramped, dark space. The two men took turns descending into the well and scooping water out of the bottom of it with buckets. And when they finally, thankfully, fished from the mud a skull that they took to be Sadako's, it was already after ten o'clock. Asakawa's deadline had come and gone, and he wasn't dead. They were satisfied that they'd figured out the secret of the videotape. After that, Asakawa took Sadako's remains back to Izu Oshima, while Ryuji returned to his apartment in Tokyo to work on an article. The case had been put to rest. The bones of Sadako Yamamura, possessor of fearsome psychic powers, had been rescued from the depths of the earth. She had been appeased. Neither Asakawa nor Ryuji had any doubt about that.
Having read that far, Ando now stood up, still holding the report, and opened the window. Imagining climbing down a rope into a well had given him the feeling that he was suffocating. It was a doubly restricted space; under the cabin it would be dark even in the daytime, and then there was the well, not even a yard across. It gave him a flash of claustrophobia; he had to breathe outside air. Directly beneath his window he could see the dark woods of Meiji Shrine swaying in the breeze. The pages in his hand fluttered too, stirred by the same current of air. The last page of the manuscript was in the printer now. One more page and Asakawa's account would be finished. Ando heard the sound of the printer finishing its task. He glanced back at the word processor only to find a mostly blank piece of paper staring back at him. He picked up the final page. It said:
Sunday, October 21 The nature of a virus is to reproduce itself. The charm: make a copy of the video.
And that was all. But it had to be of the utmost importance. October 21 st was the day of Asakawa's accident. The previous morning, Ando had dissected Ryuji's body and met Mai at the medical examiner's office. Although the manuscript ended abruptly, Ando could more or less fill in the rest himself. On October 19th, Sadako Yamamura's remains had been delivered into the custody of her relatives back home. But that hadn't been the end of things after all. Even as Asakawa sat in a hotel on Oshima composing his detailed report, Ryuji was dying in his apartment in East Nakano. Upon returning to Tokyo and learning of Ryuji's death, Asakawa had rushed to Ryuji's apartment. There he'd encountered Mai Takano and peppered her with what seemed to her strangely inappropriate questions. Ryuji really didn 't tell you anything at the end? Nothing, say, about a videotape? It was easy to see why Asakawa had been in a panic. He'd been convinced that he'd escaped death by figuring out the riddle of the videotape, and now he'd found out he was wrong. The curse still lived. And Asakawa was left without a clue. Why was Ryuji dead and Asakawa alive? Not only that, Asakawa's wife and child had a deadline of their own coming, at eleven the next morning. So Asakawa had to figure out the charm all over again, alone this time and with only a few hours to do it in. Logically, he realized that whatever it was the videotape had wanted him to do, he must have done it at some point in the past week without realizing it. Something that he could be sure Ryuji hadn't done. What could it be? Perhaps he spent the whole night wondering. And then finally, on the morning of the twenty-first, he'd had a spark of intuition, maybe, and hit upon what he was sure was the solution. He'd made a quick note of it on his word processor.
Sunday, October 21 The nature of a virus is to reproduce itself. The charm: make a copy of the video.
What Asakawa meant here had to be none other than the smallpox virus. Just before her death, Sadako Yamamura had had physical relations with the last smallpox victim in Japan, Jotaro Nagao. It was natural to assume that the virus had invaded her body. Driven to the brink of extinction, the smallpox virus had borrowed Sadako's extraordinary power to accomplish the purpose of its existence, which was to reproduce itself. But once it took the form of a videotape, the virus couldn't" reproduce on its own. It had to work through human beings, forcing them to make copies of it. If one were to fill in the missing part at the end of the tape, it would run like this: Those who have viewed these images are fated to die at this exact hour one week from now. If you do not wish to die, you must follow these instructions exactly. Make a copy of this videotape and show it to someone else. In that light, things made sense. The day after he'd watched the videotape, Asakawa showed it to Ryuji, and he also made a copy for him. Without realizing it, he'd helped the virus propagate. But Ryuji never made a copy. Sure he had the answer, Asakawa had loaded a VCR into the rented car and driven off somewhere. Undoubtedly he'd planned to make two copies of the video and show them to two other people-one for his wife, and one for his baby girl. The people he showed it to would then have to find new prey, someone else to give a copy of the video to. But that wasn't the immediate problem. The important thing was to save the lives of his wife and child. But just at the height of his relief at having saved the lives of his loved ones, Asakawa had reached into the back seat and touched his wife and daughter and found them cold. He lost control of the car. Ando felt he could understand Asakawa's catatonic state now. Not only was he devastated at the loss of his family, but he was no doubt also tormented by a question: what was the true nature of the charm? Every time he thought he had it figured out, the answer slipped through his fingers, transforming itself, claiming another life. Rage and sorrow, and an endless repetition of the question: Why? Why was he still alive? Ando put the manuscript pages in a pile on the table. Then he asked himself: Do you really believe this cock-and-bull story? He shook his head. I just don't know. He didn't know what else to say. He'd seen the unnatural sarcoma on Ryuji's coronary artery with his own eyes. Seven people were dead of the same cause. In their blood had been found a virus that closely resembled smallpox. And where had Mai disappeared to? What about that odd ambience in her apartment, which she had seemingly vacated? That hair-raising intimation he'd had that something was there? The traces left on the videotape still in her VCR? Was the tape still propagating? Would it continue to claim new victims? The more he thought, the more questions Ando had. He turned off the word processor and reached for the whiskey on the sideboard. He knew he wouldn't be able to sleep tonight without the help of alcohol.
Ando first dropped by the biochem lab and returned the word processor to Ueda, and then headed to the Pathology Department. Under his arm he carried the report he'd printed out the night before. He intended to let Miyashita read it. Miyashita sat with his head down low to the table, scratching away with a ballpoint pen. Ando dropped the report on the tabletop next to him, and Miyashita looked up in surprise. "Listen, would you do me a favor and read this?" Miyashita just stared back at Ando in amazement. "What's going on?" "I want to know what you think of that." Miyashita picked up the document. "It's pretty long." "It is, but there are things in there that will interest you. It won't take long to read." "You're not about to tell me you've been writing a novel in your spare time, are you?" "Kazuyuki Asakawa wrote up a report about the deaths." "You mean, our Asakawa?" "Right." Miyashita looked interested now as he flipped through some of the pages. "Hmm." "So, there it is. Let me know what you think when you're done." Ando started to leave, but Miyashita called him back. "Hold on a minute." "What?" Miyashita rested his cheek on his hand and tapped the table with the tip of his pen. "You're pretty good at codes, aren't you?" "I wouldn't say I'm particularly good at them. In med school, some friends of mine played around with them, but that's about it." "Hmm," said Miyashita, still tapping on the table. "Why?" Miyashita took his elbow off the printout he'd been looking at and slid it over to Ando. "This is why." He started tapping his pen on the center of the page. It was the printout he'd seen the day before, the results of sequencing the virus found in Ryuji's blood. "You showed me this yesterday." "I know, but I just can't get over it." Ando picked up the piece of paper and held it up in front of his face. Into several points in an otherwise unordered sequence of bases, a string of bases in the same order had been inserted.
Date: 2015-12-24; view: 1073
|