Home Random Page


CATEGORIES:

BiologyChemistryConstructionCultureEcologyEconomyElectronicsFinanceGeographyHistoryInformaticsLawMathematicsMechanicsMedicineOtherPedagogyPhilosophyPhysicsPolicyPsychologySociologySportTourism






PART TWO - VANISHING

 

It was already fifteen minutes past the time they were supposed to meet. Ando started to fidget. He took out his planner and checked the schedule again.

There it was: Friday, November 9th, 6:00 pm, in front of the Moai statue at the west exit of Shibuya Station. Meet Mai for dinner. He hadn't misremembered.

Ando inserted himself into the flow of passersby and made a brief circuit of the area. Each time he saw a woman of roughly Mai's age he peered at her face, but none were hers. Half an hour had passed now. Thinking maybe she'd forgotten, Ando called Mai's apartment from a pay phone. He let it ring six or seven times, fancying he could hear from the echoes how small her apartment was.

It's really tiny, she'd said. Less than five mats!

Ten rings. Obviously, she wasn't home. He brought the receiver away from his ear. No doubt something had happened to make her late. She was probably on her way. At least he hoped so, as he hung up.

His gaze kept stealing back to his watch. It had been almost an hour now.

At seven I'll give up.

It had been so long since he'd dated that he didn't even know if it was proper to wait any longer. Come to think of it, he'd never been stood up before. His wife had been pretty punctual when they were dating. He'd kept her waiting occasionally, but never she him.

He spent a while thinking back over various times he'd waited for people in the past, and as he did so, seven o'clock came and went. But Ando couldn't make himself leave. He couldn't give up while there was still some slight ray of hope. As he kept telling himself, Five more minutes .… All week long he'd been looking forward to this. He couldn't give up now.

In the end, Ando waited in the Shibuya throng for an hour and thirty-three minutes, but Mai never appeared.

 

He entered the hotel lobby and headed straight for the front desk to ask where the farewell party was being held. Funakoshi's send-off. Now that Mai had stood him up, he had no reason not to come. Plus, after standing in the chilly evening air in a throng of countless young people, he just couldn't bear to go straight back to his empty apartment. Seeking some way to salvage the evening, he'd hit on the idea of showing up at the party after all. It wouldn't hurt to kick up his heels with his friends for the first time in a while, he reasoned.

The organized-gathering part of the evening was just ending, and people were getting together in groups of threes and fives to hit the bars. This was how it always worked. The professors would go home after the main party, allowing the younger faculty to speak freely in their informal post-party binge sessions. Ando's timing was perfect; he'd come just in time to join in on one of those sessions.

Miyashita was the first one to notice him. He came over and put a hand on Ando's shoulder. "I thought you were out on a date?"

"Oh, she stood me up," Ando forced himself to say cheerfully.

"Ah, sorry to hear that. Hey, come here a second." Miyashita grabbed him by the cuff and led him over to the space by a door. He didn't seem interested in pursuing Ando's strikeout.



"What is it?" Something seemed fishy.

But before Miyashita could tell him anything, Professor Yasukawa from the Second Internal Medicine Unit walked by. Miyashita whispered, "You'll come drinking with us, right?"

"That's why I'm here."

"Great. I'll tell you later."

And then Miyashita was off to make nice with Yasukawa. As organizer, he thanked the professor for attending. Miyashita smiled and joked, his jowly face glowing. Ando couldn't but admire the way his friend managed to find favor with all the profs. If anybody else acted in such a way it would have come across as smarmy, but Miyashita knew how to carry it off.

Ando stayed by the door, waiting for Miyashita and Yasukawa's conversation to end. In the interim, several familiar faces passed by, but none did more than offer a greeting. Nobody cared to stop and talk to Ando.

His circle of friends had narrowed considerably in the time since he'd lost his son to the sea. He bore not a smidgen of a grudge against those who'd distanced themselves from him, though. He knew that the fault lay with him. Right after it had happened, everybody had crowded around him to offer help and comfort, but Ando hadn't been able to respond appropriately. Instead, he'd just dragged his misery around interminably, acting morose with his friends. "Cheer up," they'd say, but how could he? Gradually, one by one, they'd deserted him. Before he knew it, Miyashita was the only one left. Miyashita always had a joke ready, no matter how melancholy Ando's expression. Miyashita knew how to find something to laugh about in misfortune, no matter whose. The only times Ando could forget his sadness were when he was with Miyashita. By now, Ando could put his finger on what it was that set Miyashita apart from his other friends: while everyone else came to him to cheer him up, Miyashita had come to actually have fun. There was no more meaningless phrase in all of language than "Cheer up!" The only way to get someone to cheer up was to help them forget, and saying "cheer up" had quite the opposite effect, only reminding the person why he or she was depressed in the first place.

Ando knew quite well that he hadn't worn a sunny expression once all year. He tried to imagine, objectively, how he must look from Mai's perspective. Terribly gloomy, no doubt. No wonder she didn't want to have dinner with him; he'd only depress her more.

The thought, in turn, depressed him. A year and a half ago he'd been full of confidence. The future had stretched out before him, wide open and full of promise. He had a loving wife and a darling son, a ritzy condo in South Aoyama, a BMW with a leather interior, and a position as chief administrator waiting for him down the road. But he realized now that everything had been in his wife's name, or her father's, and a simple twist of fate had made it all slip through his fingers.

Miyashita was still talking with Professor Yasukawa. At a loss for what to do, Ando let his gaze wander idly around the lobby until he noticed a row of three pay phones. He took out a phone card and went over to them, thinking to dial Mai's number one last time. Cradling the receiver on his shoulder, he looked back over at Miyashita. If he lost track of his friend and missed out on the drinking session, he'd have come all the way in vain. Miyashita was in charge, here. As long as Ando stuck close to his friend, he wouldn't be stranded.

He let it ring eight times, then hung up and looked casually at his watch. Almost nine o'clock. It was three hours past the time they'd agreed to meet, and Mai still wasn't home.

I wonder where she went. He was beginning to worry about her.

Miyashita was bowing deeply to Yasukawa. Their conversation seemed to be over. As Miyashita moved away from the professor, Ando went and stood by Miyashita.

"Hey, sorry to keep you waiting." His tone was informal, a 180 degree reversal from how he'd been speaking to Yasukawa.

"No problem."

Miyashita took a scrap of paper out of his pocket and handed it to Ando.

"This is where we're going. I think you know it-it's over in the Third District. Would you do me a favor and go on ahead? I have to wrap things up here." He waved and started away, but Ando touched his elbow.

"Hold on a second."

"What?"

"What is it you want to tell me?" Miyashita's tease had been bothering at him.

Miyashita licked his lips with his thick tongue. They'd served roast beef at the party, and he was enjoying the last drops of grease. His lips glistened red as he said, "I found something."

"What?"

"A virus."

"A virus?"

"I got a call this afternoon from Yokodai University. Remember the two kids they autopsied over there?"

"The ones who died in a car of simultaneous heart attacks?"

"Yeah. Well, the thing is, a virus was found in their damaged tissue-from both of them."

"What kind of virus?"

Miyashita frowned and exhaled. "You're not going to believe it, but it looks identical to the smallpox virus."

Ando was speechless.

"Seki's diagnosis was right on the money. All he had to do was look at the ulcerations on the pharynx, and he came up with smallpox."

"This is unbelievable," Ando muttered.

"You can say that now. But I have a feeling we're going to find the same virus in Ryuji's tissue sample. Then you'll have no choice but to believe it."

Miyashita's complexion was even ruddier than usual due to the alcohol he'd consumed. It made him look vaguely happy about the whole thing. Maybe the appearance of an unknown virus was more exciting than frightening for a student of medicine.

But not for Ando. His mind had already raced ahead to wonder about Mai. The fact that she was not answering her phone bothered him no end. Her absence and the discovery of a virus that resembled smallpox seemed somehow connected. He had a bad feeling about where all of this was going.

Maybe what happened to Ryuji is happening to Mai. Maybe it's already happened.

The hotel lobby was filled with the clamor of drunken knots of people. Somewhere in the hullabaloo he could hear an infant laughing. A baby here at this hour? Ando wondered, checking the couches. But he didn't see any baby.

 

 

 

Wednesday, November 14th

Ando went to the main campus, to the philosophy department, to ask Mai's professors if she'd been attending classes recently. But everyone he asked said the same thing: they hadn't seen her for a week now. As one of the few female students in the department, she stood out like a flower. When she missed class she was conspicuous by her absence.

Ever since last Friday, Ando had been calling her place two or three times a day, but no one was ever there to pick up the phone. He couldn't imagine her camping out at a boyfriend's house that whole time, and now his inquiries at her department had only exacerbated his concern.

It occurred to him that she might have gone home, so he went to the registrar's office. He explained the situation to the person on duty there and managed to get a look at her file. He discovered that her hometown was a place called Toyoda, in Iwata County, Shizuoka Prefecture. It was two or three hours from Tokyo if you took the bullet train. Ando wrote down her phone number, and then her address, too, just in case.

As soon as he got home from work that night he dialed the number. Mai's mother answered. When Ando explained who and what he was, he heard a sharp intake of breath on the other end of the line. Mai's mother was panicking upon learning that she was talking to someone from the med school at Mai's university. Even a call from her department would have been alarming, but one from a residing doctor could only mean Mai had fallen seriously ill. Her mother was probably bracing herself for the bad news. Students at the university all got free medical examinations at the university hospital, so Mai wouldn't have had to ask her mother before going in.

But Mai's mother couldn't figure out exactly why Ando had called. She was in touch with her daughter at least two or three times a month. True, she hadn't spoken with Mai in three weeks now; when she'd called last week, Mai had happened to be out. But she couldn't understand why a doctor from her daughter's university would be calling her parents' house just because he hadn't seen her for a week. Ando could hear suspicion in the woman's voice as she carefully probed his every remark.

"So, you say your daughter wasn't at home when you called last week." Ando knitted his brow. He'd hoped to find out she'd just gone home for the week. He'd prepared himself for that minor embarrassment, but now, his bit of optimism was gone. Mai hadn't been around when her mother called the week before, either.

"I'm sure it's nothing, doctor. We had a stretch last year, too, when we kept missing each other's calls. We went almost two months without talking then!"

Ando felt antsy. He couldn't explain the situation even if he wanted to. Just the day before, they'd found in Ryuji's tissue sample the same virus that had shown up in the two Yokohama kids. They hadn't been able to establish how the contagion was passed on, or by what route it had traveled. Depending on what they turned up, perhaps the truth had to be withheld from the media. He couldn't let Mai's mother know what was going on, either.

"Excuse me for asking, but does your daughter spend the night away from her apartment often?"

"No, I don't think so," her mother said firmly.

"Do you happen to remember exactly what day it was you called her last week?"

The woman thought for a moment, then said, "Tuesday."

So she had already not been answering her phone on Tuesday. Today was Wednesday. Over a week…

"Is it possible that she's traveling?"

"No, I don't think so."

Ando wondered how she could be so sure. "Why not?"

"Well, she has a part-time job as a tutor just to pay her daily expenses. She doesn't want to be a burden on her parents, she says. I simply don't believe she has enough money to travel."

All of a sudden Ando was sure that Mai was in some terrible trouble. The Friday before, Mai had stood him up. It wasn't as if he was difficult to get hold of. If she couldn't make the date, all she had to do was give him a call the day before and tell him. But she hadn't done that. And now, he felt sure he knew why. She couldn't contact him. He recalled the Polaroids of Ryuji's corpse. No matter how hard he tried, he couldn't rid himself of the picture of Ryuji's limbs splayed out in death. It was still branded on his brain.

"Would it be possible for you to come up to Tokyo tomorrow?" As he made the request, Ando bowed even though he was talking to her over the phone.

"I'm not sure I can get away on such short notice," she sighed. Then she was silent. Ando supposed he couldn't expect her to feel a proper sense of urgency when he hadn't given her the facts of the situation. All the same, though, she seemed a little too unconcerned about the whole thing. Ando wanted to tell her just how easy it was to lose someone you loved. How you could hear her voice, turn around, and find her gone.

Mrs Takano broke the awkward silence. "If I did go to Tokyo, what exactly would you have me do? File a missing person report?"

"I'd at least like you to take a look at her apartment. I'll accompany you. We can think about a missing person report after that." But Ando didn't really believe they'd have to do that. This was- unfortunately-not that kind of case.

"I just don't know… Does it have to be tomorrow?"

She couldn't make up her mind. What errand could she have that was important enough to keep her from possibly finding her daughter dead? Ando couldn't coddle her along any longer.

"Alright, then. I'll go over to her apartment alone tomorrow. I understand she lives in a small studio. Do you happen to know if the building has a superintendent?"

"Yes, it does. I met him when I helped her move in."

"Well then, I'm sorry to impose, but could I get you to call him and tell him that Mitsuo Ando will be coming by tomorrow afternoon, between two and three, and that I'd like to take a look at Mai's room, in his presence of course?"

"Well…"

"Please. I doubt he'll give me the key if I just show up unannounced."

"Alright. I'll make the call and set it up." "Thank you. I'll call you if anything conies up." Just as he was about to hang up, Mai's mother started to say something. "Listen…" Ando waited for her to continue. "Say hello to Mai if you see her."

She doesn 't understand. Ando didn't know what to feel as he hung up.

 

Mai's apartment was only a short train ride from the university, no transfer required. Ando passed through the gate, left the station, and started to search for her apartment, map in one hand and the planner where he'd written the address in the other. He spotted a little girl in an orange kimono walking down the sidewalk ahead of him with her parents. He was reminded today was the traditional 7-5-3 festival, a celebration for boys of three and five and girls of three and seven. As he overtook and passed the trio he glanced at the child's face. She seemed a little big, her features too well-developed, for her to be just seven years old. But her festive attire was bright and cheery in the afternoon sunlight. Ando thought her incredibly cute as she wobbled down the street in her unfamiliar lacquer sandals, clutching her mother's hand. Even after he'd passed them, Ando kept stealing glances back at the three, imagining that in fifteen years the girl would grow up to be as beautiful as Mai.

He eventually located a seven-story apartment building facing a shopping arcade, the address of which matched what he'd written down in his planner. The facade was nice, but even from the outside, he could tell that the units had to be pretty small. They'd kept the rent low by cramming as many tenants as possible onto the property.

He found the superintendent's office in the lobby and pushed the buzzer. Through the window, he could see him emerge from an inner room. An older gentleman. He opened a small door in the window, and Ando gave his name.

"Oh, yes. Miss Takano's mother told me you were coming." Jangling a thick bundle of keys, he came out of the office.

"I appreciate this," Ando said.

"No, I ought to thank you. I'm afraid things haven't been going well lately with that girl."

Ando didn't know exactly what Mai's mother had told the man, so he didn't know how to respond to this, except to say, "I guess not," and follow him.

On the way to the elevator, they passed a bank of mailboxes. From one of them protruded several newspapers. Guessing it was Mai's box, Ando had a closer look. As he'd suspected, the nameplate read TAKANO. There were four rows of mailboxes, and hers was in the top row.

"That's Miss Takano's. It's hardly ever like that."

Ando took the newspapers from where they'd been wedged into the mail slot and checked the dates. The oldest one was the morning edition from Thursday, November 8th. This was the seventh day since. It had been a full week, then, since Mai had last come down to pick up her newspaper. She could be sleeping somewhere else, but he doubted it. She was in her room, alright. It's just that she couldn't come down for the paper. All signs pointed in that direction.

The super interrupted Ando's thoughts. "Okay, then, are you ready?" He sounded as if he thought Ando would back out.

"Yes, let's go." Plucking up all the courage he could muster, Ando followed the man into the elevator.

Mai's apartment was on the third floor, room 303. The super took out his bundle of keys, chose one, and inserted it into the keyhole.

Without realizing it, Ando took a step back. I should have brought surgical gloves. The virus that had brought about Ryuji's death was probably not airborne. He imagined it to be like AIDS, fairly difficult to catch. Still, it was an unknown quantity, and he should have taken precautions. Not that he was all that attached to life, but he didn't want to die just yet. At least not until he'd figured out this puzzle.

A click echoed in the hall as the lock sprang open. Ando took another step backwards, but focused his sense of smell on whatever lay beyond the door. He was well-acquainted with the stench of death. It was mid-November, a fairly dry season, but he could expect a decomposing corpse to give off a powerful odor. He steeled himself until he was confident that even if the door opened to reveal what he expected it to, he could defend against the shock.

The door opened a few centimeters, and a gust of air blew out of the room and into the hallway. The window was probably open. Catching the wind full in the face, Ando breathed in, carefully, through his nostrils. He couldn't detect the unmistakable scent of a dead body. He inhaled and exhaled several times. No smell of decay. His sense of relief was so strong that it threatened to knock him off his feet, and he put his hand against the wall to steady himself.

"After you," urged the super, waiting in the doorway. Just standing in the entrance, he could see the whole interior of the apartment. There wasn't really any "looking around" to be done. Mai's body was nowhere to be seen. So Ando's premonition had been an idle one; he relaxed and let out a deep sigh.

He took off his shoes and stepped past the super into the room.

"Where's she gone?" grumbled the super from behind him.

Ando felt a strange sort of gloom steal over him. He should have felt relieved that he hadn't found what he'd thought he'd find, but instead his heart continued to race. The room had a strange air about it, and he didn't know why.

So she hasn 't been back here in a week. It was the only conclusion he could draw. Where is she now? He wondered if the answer to the new question he was left with awaited him somewhere in the room.

Directly next to the entrance there was a small bathroom. He opened the door a crack to make sure it was empty, then returned his gaze to the main room.

He could see how she'd tried to make efficient use of her limited space. A futon was neatly folded and stashed in a corner. There wasn't enough space for a bed, nor was there a proper closet for the futon. Instead of a real desk there was a low table that had an electric space heater attached to its underside. The table was covered with manuscript pages. A discarded page had been folded up to serve as a coaster for a coffee cup, which was a quarter full of milk. Bookshelves covered one wall, and a combination TV/VCR was nestled in among the books. All the other appliances were arranged around the room almost as if they'd been built in, suggesting the care she'd put into choosing what to buy for her tiny apartment.

In front of the table sat an adjustable backrest that rocked unstably. It was covered with a penguin-print cloth. Pajamas, neatly folded, lay on the seat, with a bra and panties wadded up next to them.

Maybe it's just because I'm in a young woman's apartment? Ando was trying to figure out why he felt so uncomfortable. His chest was tight and his pulse was pounding. Seeing her underwear made him wonder if he was just an overexcited voyeur.

"What do you think, Doctor?"

The super was still standing in the doorway. He made no move to enter; he hadn't even taken off his shoes. Since she clearly wasn't to be found in her room, he seemed to have concluded that their business was finished and that it was time to go.

Ando didn't reply, walking over to the kitchenette instead. The floor here was wooden, but for some reason it felt like a thick carpet. He looked up: a ten-watt fluorescent light had been left on. He hadn't noticed it before because of the afternoon sunlight streaming in. Two glasses were in the sink. He turned the tap on, and after a while the water heated up. He pulled the string dangling from the bulb, turning out the light, and walked away from the kitchenette. When the light went out, he felt gooseflesh rising all over his body.

Nothing he saw gave him any clue as to Mai's whereabouts.

"Shall we go?" Ando said, not looking at the super. He put his shoes back on and left the apartment. He heard the key turn behind him. He finished tying his shoelaces, straightened up, and walked to the elevator ahead of the super.

As they stood there waiting for the elevator, an autopsy Ando had performed the previous summer came back to him all of a sudden. It was on a young female who'd been strangled at home in her apartment. They'd told him she'd been dead for eleven hours, but when he cut her open he found to his surprise that her organs were still at something close to normal body temperature. When a person dies, the body temperature drops at an average of one degree Celsius per hour. Of course, that's just an average, subject to all sorts of factors, such as the weather and location. All the same, it was extremely unusual to find a body still perfectly warm after eleven hours.

The elevator came up to the third floor and the doors started to open before Ando's eyes.

"Hold on a minute," he said. He didn't want to leave while any doubts lingered. The oppressive feeling he'd gotten as he'd stepped into Mai's room, the weird sensation of the wooden floor as he walked on it, almost as if it were melting away.

There was only one way he could describe the odd atmosphere of that room. It was like cutting into a body that had been dead for eleven hours and finding its insides still warm.

The elevator doors were fully open, but Ando did not step in. He was blocking the way, so the super couldn't get in either.

"Aren't you going to get in?"

Ando answered with a question of his own. "Are you sure you haven't seen her at all this last week?"

The elevator shut its doors and began its descent to the ground floor.

"If I have, then we wouldn't be here, would we?"

The super hadn't seen her. She hadn't shown up for class for a week, despite a near-perfect attendance record until now. She didn't answer the phone no matter how many times he called. A week's worth of newspapers were stuffed in her mailbox. It was clear that she'd been away since last Thursday. And yet, there was something about that place… It didn't feel like an apartment whose occupant had been away for a week. There was warmth there, and it had nothing to do with the temperature of the room. It was just that something in the air said someone had been there until just a moment ago.

"I want to have another look," Ando said, turning to the super, who looked first surprised, then troubled, and then, briefly, afraid. This last emotion did not escape Ando's notice.

The old man's afraid of something.

The super handed Ando the key ring, saying, "Just drop them off in the office when you're done." He gave Ando a look as if to say, If you want to go back, be my guest, but count me out.

Ando wanted to ask the super what his impressions of the place had been. But he'd probably be at a loss for words, even if Ando asked. That kind of thing wasn't easy to express. Ando wasn't sure if he himself could explain what he'd felt there.

"Thanks, I will," Ando said, accepting the keys and turning on his heel. He was afraid that he'd lose his nerve if he hesitated. In any case, he made up his mind to get out of there as soon as he figured out why the place felt so weird.

Once again, he opened the door. He wished he could leave it open while he was in the apartment, but it swung shut automatically when he let go. The moment it shut, air stopped flowing through the room.

Ando took off his shoes again and walked to the window. He closed it and opened the lace curtains as wide as they'd go. It was past three in the afternoon, and the window faced south; rays of sun slanted into the room. Bathed in light, Ando turned to have another look. The decor didn't strike him as particularly feminine, though it certainly wasn't masculine. If it hadn't been for the penguin design on the backrest, he wouldn't have been able to guess the inhabitant's gender.

Ando seated himself next to the backrest and picked up Mai's underwear. He brought them close to his face and sniffed them, then held them away, then sniffed them again. They smelled like milk. Takanori's undershirts had smelled like that when he was a toddler.

Ando put the underwear back where he'd found it and twisted his body until his eyes came to rest on the television. The power light glowed red: the VCR had been left on. He pushed EJECT and a tape popped out. There was a white label on its spine, with a title on it.

Liza Minnelli, Frank Sinatra, Sammy Davis, Jr/1989.

This was written in large letters, none too neatly, with a felt-tip pen. It didn't look like a woman's writing. He took the tape out and examined it. It was fully rewound. After he'd scrutinized it for a while, he slid it back into the VCR. Ando hadn't forgotten how this whole series of incidents had something to do with a video. There was the story Mai had told him about Asakawa, then the fact that Asakawa had been carrying a video deck on the passenger seat at the time of the accident.

Ando pressed PLAY.

For two or three seconds the image on the screen looked like ink being mixed with some viscous fluid. Then a point of light appeared amidst the roiling blackness. Flashing, it moved around to the left and right, and then finally started to grow. Ando felt a momentary, but distinct, unpleasantness. Then, just when the point of light looked like it was about to turn into something else, a TV commercial came on. He recognized it as one he'd seen several times already. The contrast, as the darkness gave way to sunny ordinariness, was stunning. Ando felt his shoulder muscles unclench.

The ad was followed by another, and yet another. He fast-forwarded through more of them. Then came a weather report. A smiling woman was pointing to a weather map. He fast-forwarded some more, and got to what looked like a morning talk show. The scene changed again: a reporter was looking into the camera and speaking into a microphone, something about some celebrity getting divorced. Ando kept on fast-forwarding but couldn't find anything that corresponded to the title on the label. The tape must have been recorded over.

As he watched, Ando began to relax. Of course, he hadn't been expecting to see American singers, but something altogether more horrifying. Aside from the first few seconds, however, his fears had been misplaced: all the tape contained was mundane TV programming. The talk show came to an end and was followed by a rerun of an old samurai adventure. Ando stopped the tape and rewound it. He wanted to examine the weather report segment.

He found the beginning of the forecast and pressed PLAY. The woman said, "And now here's a look at the weather for Tuesday, November 13th."

He pressed PAUSE and the image froze.

November 13th?

Today was the fifteenth. Which meant that this had been recorded the day before yesterday. But who'd been around to press RECORD?

Was Mai here just two mornings ago?

But then how to explain the newspapers in her mailbox? Had she simply forgotten to pick them up?

Or maybe … He opened the front panel of the VCR and tried to see if there was any evidence it had been programmed. It was possible that when she'd left the room a week ago, Mai had set the VCR to record something on the morning of the thirteenth.

At that moment, he heard something. It sounded like the faint splash of a drop of water. Without getting up, he turned his torso until he could see the sink in the kitchenette. But there didn't seem to be a drip there. He got up and peered into the bathroom.

The door was open a crack, just as it had been the last time he checked. He turned on the light and tried to push open the door. But it would only open halfway; the toilet blocked it. Ando leaned in through the narrow opening and saw a bathtub just large enough for someone to sit in if she drew her knees up to her chin. A nylon curtain draped down into it. He pulled the curtain out of the way and looked inside. Water dripped from the ceiling, landing with a splat; there was water pooled in the bottom of the tub. While Ando gawked, another drop fell, rippling the surface of the water. It was about four inches deep, and in one end of the tub it was swirling gently. Several strands of hair floated on the surface, and a few of them had gotten tangled as they swirled.

Ando wedged his way into the bathroom, leaning down until his head was inside the tub. The drain was a round black hole, that is to say, the plug had been pulled. Ando didn't immediately realize what that meant. The drainpipes were clogged with soap, or hair, or something, and the water wasn't draining well. But as Ando stared, he could see that the level was falling, if only gradually.

It finally occurred to Ando to ask himself who had pulled the plug.

It clearly hadn't been the super. He hadn't taken one step into the room. He hadn't even taken off his shoes.

Then who?

Ando took another step into the bathroom and crouched down. He held out his hand and hesitantly touched the surface of the water. It was still slightly warm. A few strands of hair tangled themselves around his fingers. It felt just like… sticking his hands into an eleven-hour-old corpse and finding it had maintained body temperature. The apartment had supposedly been vacant for a week. But only an hour ago, someone had filled the tub with hot water and, even more recently, pulled the plug. It was for ventilation that the window had been left open.

Ando hurriedly pulled his hand back and wiped it on his trousers.

On the other side of the toilet, directly below the toilet paper, he noticed a brownish stain. It wasn't fecal matter, but rather, like something that had been vomited up. Covered in a thin film, it retained the outline of undigested food. A reddish, square object-perhaps a piece of carrot?

Did Mai vomit this?

Ando was squatting with one foot in the tiny bathroom, but in order to examine the vomit he had to lean over. When he did so, though, he lost his balance.

He came to rest with his face pressed up against the edge of the toilet. The cream-colored porcelain digged coolly into his cheek, and he could only imagine what kind of expression he was making.

At that moment, he thought he heard someone laugh behind him.

Ando fought back the urge to scream, and froze in that ungainly posture.

It wasn't his imagination. He'd heard a distinct giggle behind him, from a point rather low to the floor. As if it had welled up from the floor, like some plant shoot poking up from the ground, blossoming forth in laughter. Ando tensed his muscles and held his breath.

"Hee-hee." There! The same giggle. He wasn't hallucinating. He was absolutely certain someone was behind him. But he could hardly move, much less turn around and look. He couldn't figure out what to do. With his face still pressed up against the smooth porcelain, he managed to call out, rather stupidly, "Is that you, super?" He couldn't prevent his voice from trembling. One foot still sticking out of the bathroom door, he thought he felt a current of air on it. Something was moving out there. Now, that something touched him on the patch of exposed skin between the hem of his slacks and the top of his socks, where they'd scrunched down. It brushed against him as it moved past, leaving behind the memory of its slithery touch. The lower half of his body shrank from it, and he let out a cry. He tried to tell himself that it was nothing; maybe a cat that'd been trapped in the room had licked his Achilles tendon. Nothing more. But it didn't work. Every one of his five senses knew that it was something else. Some unknown thing was behind him.

His face was below the top of the bathtub, so he couldn't see inside, but he could hear the water inside trying to gurgle out. There was a faint slurping sound as the water swirled down the drain, hair and all. But above that sound, he heard the floorboards creak. The creaky noise receded slowly from him.

He couldn't stand it any longer. He raised his voice in an inchoate yell, banged the bathroom door with his knee repeatedly, and even flushed the toilet. All the racket he'd caused finally gave him the courage to creep to his feet. Using his hands to steady himself, he raised himself until he was almost fully upright, and then he stopped to listen behind him. He desperately tried to think of a way to step out of the room without turning around. The hair on the nape of his neck stood on end, as if countless tiny spiders were crawling up his back.

He inched backward towards the entrance, making sure that his heel wasn't touching anything, and then he whirled around, grabbed the doorknob, and stumbled out into the hallway. He banged his shoulder on the wall, but he ignored the pain as he watched the door swing shut.

Gasping for breath, Ando headed for the elevator. The super's keys jangled in his pocket. Thank God he hadn't left them in the apartment! He certainly didn't want to go back in there again. He was sure something was in there, even though he could recall every corner of that room and he couldn't think of a single place for anything to hide. The futon was folded up neatly. The built-in wardrobe was neither wide nor deep enough. There was no place for any living thing to hide- unless it was pretty small.

An out-of-season mosquito buzzed in his ear. He tried to swat it away, but it kept right on droning about him. Ando coughed weakly and jammed his hands into his pockets. Suddenly he felt cold. The elevator was taking forever to arrive. Finally, frustrated, he looked up, only to see that it was still on the first floor. He'd forgotten to push the button. He pressed it two or three times, just to be sure, and put his hand back in his pocket.

 

 

"Hey, what's up?"

Ando didn't realize he'd been drifting away until Miyashita spoke to him. The sensations of two hours ago had become a tidal wave, threatening to rip his consciousness out by the roots. He resisted frantically, and got gooseflesh for his efforts. Miyashita's fervent monologue reached his brain only intermittently.

"Are you even listening to me?" Miyashita sounded annoyed.

"Yeah, I'm listening," Ando replied, but his expression said his mind was elsewhere.

"If there's something eating at you, maybe you ought to tell me about it."

Miyashita pulled a stool out from under the table, plopped his feet onto it, and leaned back. He was a visitor in Ando's office, but he acted as if the place were his own.

Ando and Miyashita were the only ones in the forensic medicine lab at the moment. Despite how dark it was getting outside, it was still not quite six in the evening. After his harrowing experience at Mai's apartment, Ando had come directly back to the office to meet Miyashita. As a result, he hadn't had any time to regain his equilibrium. And Miyashita had been telling him about the virus the whole time.

"No, nothing's bothering me." He had no intention of telling Miyashita what he'd experienced in Mai's apartment. He had no words to express it, first of all. He couldn't think of an appropriate metaphor. Should he compare it to that feeling you sometimes get, standing at the toilet in the middle of the night, that there's someone behind you? The one where, once you've sensed them, the monsters in your imagination just keep growing and growing until you finally turn around and dispel the illusion? But what Ando had experienced was no such run-of-the-mill affair. He was sure there'd been something behind him when he lost his balance in Mai's bathroom and hit his cheek against the toilet. It wasn't a product of his imagination. Something had emitted that high-pitched laughter. Something that had made Ando, not normally a coward, too scared even to turn around.

"You look pale, though. Paler than normal, that is," said Miyashita, wiping his glasses on his lab coat.

"I haven't been sleeping well lately, that's all." It wasn't a lie. Recently, he'd been waking up in the middle of the night and having trouble getting back to sleep.

"Well, never mind. Just don't keep asking me the same questions over and over. No one likes to be interrupted."

"Sorry."

"Now. May I go on?"

"Please do."

"About that virus they discovered in those bodies in Yokohama…"

"The one that's just like smallpox," Ando volunteered.

"That's the one."

"So it resembles smallpox visually?"

Miyashita slapped the tabletop. He flashed Ando a look of exasperation. "So you really weren't listening. I just told you: they ran the new virus through a DNA sequencer in order to analyze its bases. Then they ran it through a computer. Turns out it corresponds closely to the library data on smallpox."

"But they're not identical?"

"No. We're talking maybe a seventy percent overlap."

"What about the other thirty percent?"

"Brace yourself. It's identical to the basal sequence of an enzyme-encoding gene."

"Enzymes? Of what species?"

"Homo sapiens."

"You're kidding."

"I understand it's pretty unbelievable. But it's true. Another specimen of the same virus contained human protein genes. In other words, this new virus is made of smallpox genes and human genes."

Smallpox was supposedly a DNA virus. If it were a retrovirus, then it would be no surprise to find it had taken human genes into itself. Such a virus would have reverse transcription enzymes. But since DNA viruses didn't have them, how did this one pick up human genes and incorporate them into itself? Ando couldn't think of any process. And with one virus containing enzymes and another proteins, it meant that together they contained human genes, but in separate components. It was as if the human body had been broken down into hundreds of thousands of parts, and those parts apportioned out individual specimens of a virus for safekeeping.

"Is the virus from Ryuji's body the same?"

"Finally, we come to that. Just the other day, we found a nearly identical virus in a frozen sample of Ryuji's blood."

"Another smallpox-human combo?"

"I said 'nearly'."

"Okay."

"It's almost identical. But in one segment, we found a repetition of the same basal sequence."

Ando waited for Miyashita to continue, and he did.

"No matter where we cut it, we kept coming up with a repetition of the same forty-odd bases."

Ando didn't know what to make of it.

"Are you following me? They didn't find this in the two bodies in Yokohama."

"So you're saying that the virus found in their bodies is subtly different from the one that killed Ryuji?"

"That's right. They look alike, but they're slightly different. Of course, we really can't say much until we get data from the other universities."

At that moment a phone rang two desks over. Miyashita cursed under his breath. "What now?"

"Excuse me a minute, okay?" Ando leaned over and picked up the receiver. "Hello?"

"I'm Yoshino from the Daily News. I'm calling for a Dr Ando."

"That's me."

Yoshino wasn't quite satisfied. "Are you Dr Ando the lecturer in forensic medicine?"

"Yes, yes."

"I understand you performed an autopsy on a Ryuji Takayama at the Tokyo Medical Examiner's Office on the twentieth last month. Is that correct?"

"That's right, I was in charge of that one."

"I see. Well, I'd like to ask you a few questions about that, if I may. Can we meet?"

"Hmm." While Ando deliberated, Miyashita leaned over and whispered in his ear.

"Who is it?"

Ando covered the mouthpiece with his hand before answering. "A reporter from the Daily News." Then he quickly brought the receiver back to his mouth and asked, "What is this about?"

"I'd like to ask your opinion regarding a certain series of incidents."

The man's phrasing took Ando by surprise. Had the media already caught a whiff, then? It seemed far too early for that. Even the various med schools in charge of the autopsies had only begun to discover a connection among the deaths of the last two weeks.

"What series of incidents do you mean?" Ando decided to play dumb to try to find out how much Yoshino knew.

"I mean the mysterious deaths of Ryuji Takayama, of Tomoko Oishi, Haruko Tsuji, Shuichi Iwata, and Takehiko Nomi-and of Shizu Asakawa and her daughter."

Ando felt as if he'd been hit on the head with a board. Who'd leaked all that? He didn't know what to say.

"So how about it, doctor? Think you have time to meet with me?"

Ando wracked his brain. Information always flowed downhill, so to speak, from those who had more of it to those who had less. If this reporter had more information about the case than Ando, then perhaps Ando should try to get it from him. There was no need for Ando to show all his cards. The thing to do was to find out what he needed without giving up his own secrets.

"Alright, let's do it."

"When would be best for you?"

Ando took out his planner and looked at his schedule. "I assume you'd like it to be as soon as possible. How about tomorrow? I'm free for two hours after noon."

There was a pause as Yoshino checked his schedule.

"Okay, good. I'll come to your office at noon sharp."

They hung up nearly simultaneously.

"What was that all about?" Miyashita asked, tugging on Ando's sleeve.

"It was a newspaper reporter."

"What does he want?"

"He wants to meet me."

"Why?"

"He said he wants to ask me some questions."

"Hmmph," sighed Miyashita, thinking.

"It sounds like he knows everything."

"So what does that mean? A leak?"

"I guess I'll have to ask him that when I see him tomorrow."

"Well, don't tell him anything."

"I know."

"Especially that it involves a virus." "If he doesn't know already, you mean." Suddenly Ando remembered that Asakawa also worked for the company that published the Daily News. If he and Yoshino knew each other, maybe Yoshino was in pretty deep. Maybe tomorrow's meeting would turn up some interesting information. Ando's curiosity was piqued.

 

 

 

Yoshino kept reaching for his water glass. He'd pretend like he was going to pick it up, and then look at his wristwatch instead. He seemed to be worried about the time. Maybe he had another appointment right afterwards.

"Excuse me for a moment, will you?" Yoshino bowed and stood up from the table. Threading his way between the tables on the cafe terrace, he went over to the pay phone next to the cash register. As Yoshino flipped open his notepad and started punching buttons on the phone, Ando was finally able to stop for breath. He leaned back in his chair.

An hour ago, at exactly noon, Yoshino had shown up at his office at the university. Ando had taken him to a cafe in front of the station. Yoshino's business card still lay before him on the tabletop.

Kenzo Yoshino. Daily News, Yokosuka Bureau.

What Yoshino had told him, Ando couldn't believe. It had left his head spinning. Yoshino had come in, sat down, and launched into a monologue that did nothing but seed Ando's mind with doubts. Now he'd gone off to call God knew who.

According to Yoshino, the whole thing had started on the night of August 29th, at a place called Villa Log Cabin, a property of the South Hakone Pacific Land resort, located where the Izu Peninsula met the mainland. A mixed-gender group of four young people who stayed a night in cabin B-4 had found a videotape recorded psychically by some woman. A videotape that killed anyone who watched it, exactly a week later. What the hell?

It sounded like nonsense no matter how many times Ando went over it in his head. "It's probably something akin to psychic photography," Yoshino had said, as if that explained it. Mentally projecting an image onto a videotape? That was out and out impossible. And yet… Suppose he told somebody about the numbers he'd found on the piece of newspaper that poked out of Ryuji's belly? Or the strange vibes he'd felt in Mai's apartment? Wouldn't people think he was talking nonsense? There was just no equating what you've experienced yourself with what you've heard from someone else; one could never feel as real as the other. But Yoshino had been directly involved, and what he said was substantiated by Ando's own experience, at least. He'd helped Asakawa and Takayama investigate the case. His words were not entirely lacking in persuasiveness.

"Sorry to keep you waiting," Yoshino said, returning to his seat. He quickly wrote something in his notebook, then poked his bearded cheek with the tip of his pen. His beard looked wiry, and it was long and full, as if to compensate for the thinning at the top of his head. "Now, where was I?" He leaned forward, bringing his hirsute visage closer to Ando. He had a certain charisma that came through when he spoke.

"You were starting to tell me how Ryuji got involved."

"Right. Now, if you don't mind, what was your relationship with the late professor?"

"We were classmates in med school."

"Okay, that's what I'd heard."

Ando interpreted the remark to mean that Yoshino had run a check on him before contacting him.

"By the way, Mr Yoshino, have you watched the tape yourself?" The question had been weighing on Ando's mind for a while.

"You've got to be kidding," Yoshino said, wide-eyed. "You'd have met me in the autopsy room then. No, I don't have the guts." He chuckled.

Of course, Ando had had a sneaking suspicion for some time now that a videotape was involved in these deaths. But never in his wildest dreams did he suspect the existence of a video that killed anybody who watched it in exactly a week's time. He still couldn't quite believe it. How could he? He couldn't accept such a thing, short of watching the video himself. Even then, he'd probably only truly believe it a week later, at the moment death came for him.

Yoshino drank his now-cold coffee, taking his time. He must have gained a little leeway in his schedule, because his movements no longer signaled haste.

"So why is Asakawa still alive? He watched the tape, didn't he?" There was a note of scorn in Ando's voice. Asakawa might be catatonic, but he was still alive. That didn't seem to square with Yoshino's story.

"You've hit the nail on the head, there. That's exactly what's bothering me, too," Yoshino said, leaning forward. "I suppose the best thing to do is to ask the man himself, but I tried that and it got me nowhere." Yoshino too had visited the hospital in Shinagawa, and he too had failed to communicate with Asakawa.

Then Yoshino seemed to have an idea. "Maybe…" he trailed off portentously.

"Maybe what?"

"I think you know what I'm talking about. If we could just get our hands on it."

"On what?!"

"Asakawa's a reporter for our weekly news magazine."

Ando had no idea what Yoshino was getting at. "I know."

"Well, he mentioned to me that he was putting together a comprehensive report on all this. I mean, the whole reason he got interested, to begin with, was that he thought he was onto a scoop. He teamed up with Takayama, and the two of them rushed off to Atami, and then to Oshima Island, hoping they'd find clues to unlock the riddle of the videotape. I think they found something. And I'll bet you anything that it's all written up and stored on a floppy disk." Yoshino turned his head, leaving Ando staring at his profile.

"Ah-ha."

Yoshino faced Ando again, this time with a bitter expression. "I just don't know where it is. I couldn't find it in his apartment." Having said this, he stared off into space.

Asakawa was hospitalized, and his wife and daughter were dead. The apartment was empty. Was Yoshino saying he'd broken in and searched it? "His apartment?"

"Yeah, well, the building manager's an old softie. All I had to do was come up with a good excuse, and he let me right in with the master key."

It was the same thing Ando himself had done just the other day, out of concern for Mai, so he knew he couldn't criticize Yoshino's behavior. The motives may have been different, but in the end, they had both done the same thing: they had ransacked apartments in their occupants' absence.

Yoshino didn't look ashamed in the least, only annoyed. "I searched every corner of that place. Didn't find anything. Not his word processor, not the floppy disk." Yoshino bounced his knee with nervous energy. Then he noticed and placed a hand on the knee, flashing Ando a rueful smile.

Ando was recalling the photos he'd been shown of the scene of Asakawa's accident. He remembered the one that showed the interior of the car from the vantage point of the driver's side window. The thing he understood to be a video deck sat on the passenger's seat, wedged under the back of the seat where it had been pushed forward; on the floor on the passenger's side lay what looked like a laptop. The pair of black objects had made a deep impression on Ando. And now they gave him an idea. He turned his head, desperately trying to think, pretending to watch the crowd flowing out of the station like a human tidal wave.

Ando realized he knew where to find the report that could explain everything. No doubt Yoshino had searched Asakawa's apartment with great diligence, but the word processor and disk weren't there at all. Yoshino didn't know that Asakawa had brought them with him wherever he'd last been to, that they were in the car at the time of his accident.

Ando was now fairly confident he could get his hands on that disk, and he had no intention of sharing the information with Yoshino. He'd decide whether or not to tell the media only after he'd read Asakawa's report. Right now, all he knew was that this smallpox-like virus had been found in all seven of the corpses in question. They weren't ready yet to announce their findings in professional circles. In fact, they were only beginning to put together a research team consisting mainly of Shuwa and Yokodai people. If he went and let the media in on it at this stage, there was no telling what kind of panic they'd whip up. He had to proceed with utmost caution to make sure things didn't get out of hand.

Yoshino spent the rest of their meeting lobbing predictable questions at Ando. What were the results of the autopsy? What did he determine was the cause of death? Was any part of Yoshino's story suggestive in terms of the results of the autopsy? The reporter kept his face buried in his notebook as he went through his list.

Ando tried to answer each question as politely and as unobjectionably as he could. But all the while, his thoughts were lunging in another direction. He had to get his hands on that floppy disk right away. What did he need to do to make that happen?

 

 

 

The next day was Saturday. After finishing two autopsies, Ando took aside the young cop who was there as a witness and asked him what happened to cars that had been in accidents. If a car had been wrecked in an accident near the Oi exit of the Metropolitan Bayside Expressway, for instance, what was done with it?

"Well, first we'd inspect it." He was a trusty-looking young man with glasses. Ando had seen him several times before, but this was the first time he'd spoken to him.

"Then what?"

"Then we'd return it to the owner."

"What if it's a rental?"

"We'd return it to the rentacar agency, of course."

"Okay. There were three people aboard this car, a young couple and their daughter. They, ah, lived in a condo in Shinagawa, just the three of them. The wife and child died in the accident, and the husband is in critical condition. Now, what happens to the items that were in the car?"

"They'd be kept in temporary storage in the traffic division of the local precinct."

"For an accident that happened at the Oi off-ramp of the Metropolitan Expressway, what's the local precinct?"

"The exit?"

"Yeah, that's right. Near the exit."

"No, I mean, was it on the expressway or off it? They're different jurisdictions."

Ando thought back to the photos of the accident scene. He was certain it had happened on the expressway itself. He seemed to remember seeing the phrase "Tokyo Harbor Tunnel entrance" written in a file somewhere.

"It was definitely on the expressway."

"Then it'd be the Metropolitan Expressway Traffic Patrol Unit."

Ando had never heard the name before. "Where's the headquarters?"

"Shintomi."

"Alright. So the items would be stored there temporarily. What next?"

"They'd contact the family and have someone come and get the items."

"Suppose, like I said, everybody in the family's dead."

"Even the siblings and parents of the man in the hospital?"

Ando knew nothing about Asakawa's parents and siblings. Judging from the man's age, there was a good chance that his parents were still alive. It raised the possibility that they were in possession of whatever was in the car. Asakawa and Ryuji had been classmates in high school. Since Ryuji's parents lived in Sagami Ohno, Asakawa's probably lived somewhere in that area, too. In any case, the first thing Ando should do was to look them up and contact them.

"I see. Thank you very much."

Ando released the young cop and straightaway set about locating Asakawa's parents.

He determined that they were both alive and living in the Kurihara section of the city of Zama, not far from Sagami Ohno. He placed a call and asked what had happened to the items from their son's car. Asakawa's father told him, in a strained voice, to call his eldest son, who lived in Kanda, in Tokyo. Kazuyuki, it turned out, was the youngest of three brothers: the oldest worked in the art book division of Shotoku, a major publisher, while the middle son was a junior high school Japanese teacher. Asakawa's father said that he had in fact received a call from the police asking him to come down and pick up some items they were keeping at the station, but instead of going to get them himself, he'd told them to contact his son in Kanda. Kanda wasn't too far from Shintomi, where the Metropolitan Expressway Traffic Patrol Unit had their headquarters, and Asakawa senior hadn't felt like lugging a word processor and a VCR home at his age-he was over seventy. So he'd arranged with the police for his son to pick up the items.

Ando's next move, then, was to contact Junichiro Asakawa, who lived with his wife in a Kanda condominium. When he finally managed to get in touch with him that evening, Ando came straight out and told him the situation, or most of it at least. He was afraid that if he aroused Junichiro's suspicions by slapping together a lie or a clumsy cover-up, he might never get his hands on the disk. On the other hand, he couldn't simply repeat the story Yoshino had told him. Ando didn't believe most of it himself, and Junichiro would surely think he was crazy. So he abridged things as he saw fit, ending by emphasizing that there was a possibility that Asakawa had left behind a document that might shed some light on what was happening. Speaking on behalf of the Medical Examiner's Office, he said he'd really like to get his hands on that document and wondered if he might be allowed to make a copy of it, please and thank you.

"I'm not sure there was anything like that in what I was given." Junichiro didn't sound entirely convinced. The way he spoke suggested that he hadn't yet taken a good look at the items.

"Is there a word processor?"

"Yes. But I think it's broken."

"Was there a floppy disk inside it?"

"To be honest, I haven't checked. I haven't even taken it out of the cardboard box they handed it to me in."

"Was there a video deck along with it?"

"Yes, but I threw it away. Was that the wrong thing to do?"

Ando's breath caught in his throat. "You threw it away?"

"I can see why he'd be carrying around the word processor, because of his job, but why did he have a VCR with him?"

"Excuse me, but did you say you threw it away?"

"Yes. It was a total wreck. I'd arranged garbage pick-up for a TV the other day, so I had them take the VCR away at the same time. It was beyond repair. Anyway, I doubt Kazuyuki'll mind."

Ando had almost caught his two quarries, and now, at the last minute, one had eluded him. There'd been a good chance that the videotape that held the key to all this had been inside the VCR, and with luck he'd hoped to get his hands on both it and the floppy disk. He was kicking himself for not having contacted Junichiro sooner.

"Besides the VCR, there wouldn't happen to have been a videotape, would there?" Ando said a little prayer as he asked.

"I don't know. All I saw was the word processor, the VCR, and two black leather gym bags that probably belonged to Shizu and little Yoko. I haven't opened them."

Ando made sure Junichiro understood that he wanted to see them as soon as possible. "Would you mind if I paid you a visit?"

"That's fine," Junichiro agreed, surprisingly quickly.

"How about tomorrow?" Sunday.

"Let's see. I'm playing golf with one of my writers, but I should be back by seven."

"Well, then, seven it is." Ando made a note of the time, and underlined it several times.

 

At just after seven o'clock on Sunday evening, Ando called at Junichiro's condo in the Sarugaku section of Kanda. The neighborhood didn't feel very residential. Junichiro's building was surrounded by office blocks. The area was eerily quiet on Sunday evenings.

Ando rang the bell and heard a man's voice from behind the door ask, "Who is it?"

"This is Ando. I called yesterday."

The door opened immediat


Date: 2015-12-24; view: 937


<== previous page | next page ==>
Liza Minnelli, Frank Sinatra, Sammy Davis, Jr/1989 4 page | ATGGAAGAAGAATATCGTTATATTCCTC CTCCTCAACAACAA
doclecture.net - lectures - 2014-2026 year. Copyright infringement or personal data (0.303 sec.)